Research Article

Journal of Agricultural, Life and Environmental Sciences. 31 March 2023. 14-25
https://doi.org/10.22698/jales.20230002

ABSTRACT


MAIN

  • Introduction

  • Materials and Methods

  •   Plant and sample preparation

  •   Genomic DNA extraction

  •   Binary mixture sample

  •   Blind samples

  •   Cloning of the PCR amplicons and DNA sequencing

  •   Sequence analysis and specific primer design

  •   Quantitative real-time PCR assay

  •   Standard curve analysis for real-time PCR

  • Results and Discussion

  •   Development of DNA markers according to species

  •   Evaluation of efficiency and reproducibility of the target-specific primer sets

  •   Estimation of the sensitivity and specificity of the developed qPCR assay

  •   Reliability verification of the developed primers using blind samples

Introduction

Herbal plants have long been used in medicine to prevent and treat various human diseases. Recently, interest in and demand for herbal medicines have surged tremendously in developing and developed countries (Ekor, 2013). According to a report by the World Health Organization (WHO), most developing countries depend on herbal medicines to treat human diseases (WHO, 2007). Owing to the increased demand for herbal medicines, interest in the safety of herbal medical products has increased; however, the effects of many plants used as medicinal herbs on human health have not been examined, and concerns regarding potential side effects are increasing (WHO, 2002). Therefore, the use of medicinal herbs, verified by their effect and origin, has been important in the protection of consumer rights in the medical herb market.

The Rosaceae family is a flowering plant family comprising 4,828 species in 91 genera; these species are particularly found in Europe, North America, and Asia. Plants belonging to Rubus, the genus to which R. coreanus and R. occidentalis belong, are widely cultivated as fruit trees and medicinal crops. When used as a medicinal crop, Rubus plants are reported to have antioxidant, antinociceptive, anti-inflammatory, and antipruritic effects (Patel et al., 2004; Seo and Ahn, 2004). Among them, R. coreanus is a plant native to Korea, and its unripe fruit corresponds to the original plant of a medicinal material called “Bokbunja” (MFDS, 2022). R. coreanus is a plant with traditional medicinal properties in Korea and is mainly used to treat diabetes, asthma, and allergies. In contrast, R. occidentalis is called “black raspberry” in North America and is widely used as a raw material for various processed foods (Kim et al., 2014). R. occidentalis, whose fruits are morphologically similar to those of R. coreanus, is cultivated in most regions of Korea since its introduction from North America in the late 1960s. R. coreanus extracts have been reported to have higher anti-inflammatory activity than those of R. occidentalis (Yang et al., 2007). Although both species have different medicinal effects in different origins, they have been used confusedly due to the common name, “Bokbunja,” in Korea (MFDS, 2022).

Various techniques have been developed to identify impurities in processed food products, including morphological, physicochemical, DNA-based, chromatographic, and spectroscopic methods (Hong et al., 2017). Among them, DNA-based analysis can detect only the target components in processed food products with high accuracy and efficiency compared to other methods (Kane and Hellberg, 2016). Representative DNA-based molecular markers, such as multiplex PCR and quantitative real-time PCR (qPCR), have been developed and are widely used to detect counterfeit ingredients in processed food products. However, multiplex PCR is difficult to optimize owing to cross-reactivity between combined primers and low sensitivity in complex food products (Xu et al., 2012). In contrast, qPCR is highly sensitive to complex food products and can quickly detect only the target species. Generally, qPCR can be designed as either dye-based qPCR (e.g., SYBR Green assay) or probe-based qPCR (e.g., TaqMan assay) (Arya et al., 2005). However, it is more difficult to optimize the TaqMan method than the SYBR Green-based qPCR method because more SNPs and InDels are required by the TaqMan method to distinguish the target species (Safdar and Junejo, 2015; Şakalar and Kaynak, 2016). As the SYBR Green-based qPCR assay can discriminate target species without the use of probes, it can be conveniently optimized even with a small number of SNPs and InDels between target and nontarget species and is associated with a low manufacturing cost (Safdar and Junejo, 2015).

Although the anti-inflammatory effects (Yang et al., 2007) and antioxidant effects (Kim et al., 2014) of both extracts of R. coreanus and R. occidentalis have been reported, the discrimination of both plants based on molecular markers has not been reported. In this study, molecular markers were developed to distinguish the two species, which have been confusedly called "Bokbunja,” using an inexpensive and convenient SYBR Green-based qPCR assay. In addition, the specificity and reliability of the developed molecular markers were verified through specificity and blinding tests.

Materials and Methods

Plant and sample preparation

R. coreanus and R. occidentalis leaves were provided by the Forest Life Resources Research Department of the National Academy of Forest Sciences (Suwon, Korea). The samples used to evaluate the specificity of the developed primers were purchased from the local market and stored in sealed containers at (20-21°C). Genomic DNA (gDNA) was extracted from the ground powder of fresh or dried leaves using a mortar and pestle in liquid nitrogen.

Genomic DNA extraction

To isolate gDNA from small samples of R. coreanus and R. occidentalis leaves, the DNeasy Plant Pro Kit (Qiagen, Hilden, Germany) was employed. In contrast, large-scale gDNA extraction, such as using binary mixing tests, was performed using a modified large-scale CTAB-based method (Minas et al., 2011). The obtained gDNA was purified using the Wizard DNA Clean-up System (Promega, Madison, WI, USA) to obtain high-quality gDNA. The extracted gDNA was measured using a SPECTROstar Nano Leader (BMG Labtech, Otenberg, Germany), and the purity of the extracted DNA was between 1.7 and 2.0.

Binary mixture sample

Quantitative reference binary mixtures were generated to assess the applicability of the developed discrimination method to commercial products. The binary mixture was obtained by combining the R. coreanus and R. occidentalis powders, and a quantitative binary mixing model was developed at ratios of 0.1% (2 mg), 1% (20 mg), 10% (200 mg), and 100% (2 g), respectively. In addition, impurities at concentrations less than 0.1% are generally not considered due to unintentional illegal reasons. The Real-Time PCR cycle threshold (Ct) for the target species of all binary mixtures was applied with a cutoff value of 0.1% according to a previous report (Oh and Jang, 2020).

Blind samples

The blind mixtures were obtained from the Ministry of Food and Drug Safety, National Food and Drug Administration (Cheongju, Korea). The mixtures were randomly divided into 25 samples with different ratios of R. coreanus and R. occidentalis. A final dose of approximately 300 mg of the mixture was obtained from the leaf powders of R. coreanus and R. occidentalis.

Cloning of the PCR amplicons and DNA sequencing

Conventional PCR was performed using a VeritiProTM Thermal Cycler (Thermo Fisher Scientific, Massachusetts, USA) to obtain accurate sequences of the target genes of R. coreanus and R. occidentalis. PCR mixtures were prepared using TaKaRa Ex Taq DNA polymerase (Kusatsu, Shiga, Japan) with 10 ng of gDNA and 10 pmol of each primer. The PCR cycling program consisted of 35 cycles of pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 58-64°C (depending on primer set) for 30 s, and extension at 72°C for 1 min, and a final extension step at 72°C for 5 min. The PCR products were then cloned using the RBC T&A cloning vector (Real Biotech Corporation, Taipei, Taiwan), and plasmid DNAs were extracted using a DokDo-Prep Plasmid Mini-Kit (ELPISB, Daejeon, Korea). The extracted plasmid DNAs were sequenced by a commercial company (Macrogen, Seoul, Korea).

Sequence analysis and specific primer design

To design species-specific primer sets for the two target species, sequences of R. coreanus [atpA (NC_042715.1), rpoC2 (NC_042715.1), and matK (LC515928.1)], and sequences of R. occidentalis [matK (MK520558), rpoB (NC_060646.1), and the internal transcribed spacer (ITS) (MT078686.1)] were downloaded from the National Center for Biotechnology Information (NCBI) database. The nucleotide sequences were subjected to multiple alignments using ClustalW2 (www.ebi.ac.uk). Species-specific markers were designed based on SNPs in the aligned sequences. The designed primers were synthesized by a commercial company (Macrogen).

Quantitative real-time PCR assay

Quantitative real-time PCR was performed using the AccuPower® 2X GreenStar qPCR Master Mix (Bioneer, Daejeon, Korea). The real-time PCR reaction mixture contained 10 µL of 2X GreenStar Master Mix; 0.5 µL of 10 pmol each primer; 1 µL of 10 ng・µL-1 genomic DNA; 0.25 µL of ROX Dye; and distilled water up to final volume of 20 µL. Real-time PCR was performed using the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). After 10 min of pre-denaturation at 95°C, 40 cycles of denaturation for 30 s at 95°C, annealing for 20 s at 58-64°C (depending on the melting temperature of each target primer), and extension for 30 s at 72°C were carried out. All real-time PCRs were performed in triplicate.

Standard curve analysis for real-time PCR

The efficiency and sensitivity of the developed primer set were evaluated using standard curves with a subsequent series (10 ng-1 pg/µL) of target and non-target gDNA. The standard curve was defined as the number of cycle thresholds (Ct) observed in qPCR experiments at threshold levels of log-based fluorescence in five series of 10-fold dilutions of extracted gDNA (Yuan et al., 2006). Correlations between standard curves and diluted DNA were estimated using default parameters. The standard curve was calculated as:

(1)
y=-ax+b

where a is the standard curve slope and b is the y-intercept.

The percentage efficiency was determined using:

(2)
(E-1)×100%

The reaction efficiency (E) was determined using. (ENGL, 2008; Lo and Shaw, 2018)

(3)
E=(10-1/a)

Interlaboratory validation was performed in two different laboratories to validate the reproducibility and accuracy of the developed primer sets for the discriminant method. Interlaboratory validation was performed using an Applied Biosystems 7500 Fast Real-Time PCR Instrument System (Applied Biosystems, Foster City, CA) and a Step 1 Plus Real-Time PCR System (Applied Biosystems), with the application of identical qPCR conditions. All real-time PCRs were performed in triplicate.

Results and Discussion

Development of DNA markers according to species

Species-specific primer sets were designed to differentiate between the raw materials of R. coreanus and R. occidentalis, which can be misused in medicinal herb markets. The primer set was designed based on the SNPs found in chloroplast genes, such as matK, atpA, rpoC2, and rpoB and the ITS region of the nuclear genome between both genomes. Chloroplast genes and the ITS region are well-conserved regions among plants and are commonly used to design species-specific markers (Kim et al., 2022; Oh et al., 2022; Uh and Jang, 2022). After downloading the sequences of matK, atpA, rpoC2, and ITS of R. coreanus and R. occidentails from NCBI, we designed cloning primers to confirm the sequences of reference samples, such as the leaves of R. coreanus and R. occidentalis obtained from national institutes. The identity of both sequences from the database and the references was 100% (data not shown). Based on the obtained sequences, alignments were performed using the software programs, ClustalW2 and BioEdit 7.2. All species-specific primers were designed based on the SNP between the two species (Fig. 1). Generally, the processes of medicinal herb markers involve drying, heating, and cutting, which can affect the quality of DNA in complex food products (Lo and Shaw, 2018). Therefore, we amplified relatively short amplicons from 92 to 184 bp, as low-quality DNA can reduce the efficiency of qPCR (Table 1).

https://cdn.apub.kr/journalsite/sites/ales/2023-035-01/N0250350102/images/ales_35_01_02_F1.jpg
Fig. 1.

Standard curve of the designed species-specific primer sets based on the efficiency and correlation coefficient (R2) for 10-fold serially diluted gDNA of the target species. Navy and gray dots indicate the target and non-target species, respectively. The x-axis represents log DNA concentration (ng), and the y-axis represents mean Ct value ± SD. All reactions were performed in triplicate (n = 3).

Table 1.

Information of the target-specific primer sets developed in the present study

Target Species Target Gene Primer Length
(bp)
Sequence (5’ → 3’) Size
(bp)
Tm
(°C)
All plants 18s rRNA region 18s rRNA_F 24 TCGATGGTAGGATAGTGCCCTACT 109 58
18s rRNA_R 23 TGCTGCCTTCCTTGGATGTGGTA
Rubus
coreanus
matK RC_matK_F 20 AGGAGCAAGAATAATCTTGT 92 58
RC_matK_R 20 CTCTTTCTTCACGAGTATTG
atpA RC_atpA_F 19 GGCTAAACCTATTGATGGC 136 64
RC_atpA_R 22 CATCGAATCAATAGCAATAAGT
rpoC2 RC_rpoC2_F 18 GACACAATGGCGTCTTGG 149 62.5
RC_rpoC2_R 22 ACCGTCCGCAATTTCATATATT
Rubus
occidentalis
matK RO_matK_F 18 CGCCCAAGTGGACTTAGT 184 63
RO_matK_R 20 TCTTTCAAGCATACGACGGA
rpoB RO_rpoB_F 16 TTCGCCACCAACCGTC 184 62
RO_rpoB_R 26 CATTTATACCGATACTGATAAGATCT
ITS RO_ITS_F 17 CTCGTCCCTTTTCTCGA 173 60
RO_ITS_R 16 TGACGTAACCAACCGC

Evaluation of efficiency and reproducibility of the target-specific primer sets

The efficiency and reproducibility of the six pairs of primer sets (RC_matK, RC_atpA, RC_rpoC2, RO_matK, RO_rpoB, and RO_ITS) were examined in R. coreanus and R. occidentalis. For efficiency, regression analysis was performed using serially diluted 10-fold samples (10-10-3 ng/µL) of genomic DNA extracted from the leaves of the target species. The slopes of the six primer sets were between -3.18 and -3.55, and the efficiencies according to the slope were between 91.10 and 106.27%. In addition, the correlation coefficients (R2) were higher than 0.99 (Fig. 2). The range of primer amplification efficiency satisfied the guidelines of the European Network of GMO Laboratories (ENGL) (R2 > 0.98, Slope -3.1 to -3.6, efficiency 90.0 to 110.0%). The reproducibility of the developed primers was then verified in independent laboratories using different real-time equipment. The test was conducted in a total of two laboratories, and the results revealed a slope of -3.11 to -3.49, and an efficiency according to the slope of 93.55 to 109.57%. The correlation coefficient (R2) was 0.98 or more (Table 2). Therefore, the developed primer sets were suitable for detecting target species in complex food products.

https://cdn.apub.kr/journalsite/sites/ales/2023-035-01/N0250350102/images/ales_35_01_02_F2.jpg
Fig. 2.

Standard curve of the designed species-specific primer sets based on the efficiency and correlation coefficient (R2) for 10-fold serially diluted gDNA of the target species. Navy and gray dots indicate the target and non-target species, respectively. The x-axis represents log DNA concentration (ng), and the y-axis represents mean Ct value ± SD. All reactions were performed in triplicate (n = 3).

Table 2.

Results of inter-laboratory real-time polymerase chain reaction analysis

Target species Primer Laboratory 1 Laboratory 2
Y
(Slope)
R2 Efficiency
(%)
Y
(Slope)
R2 Efficiency
(%)
Rubus coreanus RC_matK -3.17 1.00 106.99 -3.44 1.00 95.15
RC_atpA -3.26 1.00 102.84 -3.26 1.00 102.84
RC_rpoC2 -3.17 1.00 106.58 -3.17 1.00 106.58
Rubus occidentalis RO_matK -3.25 0.99 103.03 -3.31 1.00 100.52
RO_rpoB -3.46 1.00 94.42 -3.49 1.00 93.55
RO_ITS -3.11 1.00 109.57 -3.29 1.00 101.27

Estimation of the sensitivity and specificity of the developed qPCR assay

A binary mixture test was performed to estimate the sensitivity of the primers developed in this study to detect only the target species when R. coreanus and R. occidentalis were mixed. The slopes using primer sets of R. coreanus in binary mixtures of different ratios (0.1% to 100%) ranged from -3.15 to -3.19, and the resulting efficiencies ranged from 105.71 to 107.24 (Fig. 3A). The measured slope of the primer sets of R. occidentalis ranged from -3.18 to -3.45, and the corresponding efficiencies ranged from 94.56 to 105.90 (Fig. 3B). The R2 values for all six primer pairs were 0.98 or more. The results of the binary mixture test indicated that all six primer pairs had high sensitivity for detecting the target in mixed food products. Additionally, the limit of quantitation (LOQ) for all real-time methods was 0.1% of the target species. Therefore, the cut-off Ct value to confirm the presence of the target species was set to 0.1% Ct of the target species in the binary mixture. The cut-off Ct values ​​ranged from 25.64 to 26.97 cycles for each primer set targeting R. coreanus and 24.43 to 26.05 cycles for each primer set targeting R. occidentalis (Fig. 3).

https://cdn.apub.kr/journalsite/sites/ales/2023-035-01/N0250350102/images/ales_35_01_02_F3.jpg
Fig. 3.

Threshold cycles (Ct) obtained based on efficiencies and correlation coefficients (R2) for reference binary mixtures. The x-axis represents log percentage of the target species (%), and the y-axis represents mean Ct value ± SD. Plotted against the logarithm of target species concentration (100%, 10%, 1%, and 0.1%). (A) Rubus coreanus powder was mixed with R. occidentalis powder, and 10-fold serial dilutions (0.1%, 1%, 10%, and 100%, total mass of 2 g) were prepared. Each gDNA mixture (10 ng・µL-1) was amplified using the species-specific primer sets (RC_matK, RC_atpA, and RC_rpoC2) for R. coreanus. The red dotted line indicates Ct values for 0.1% binary mixture amplified using the R. coreanus-targeting primer sets. (B) R. occidentalis powder was mixed with R. coreanus powder, and 10-fold serial dilutions (0.1%, 1%, 10%, and 100%, total mass of 2 g) were prepared. Each gDNA mixture (10 ng・µL-1) was amplified using the species-specific primer sets (RO_matK, RO_rpoB, and RO_ITS) for R. occidentalis. The yellow dotted line indicates the Ct values for 0.1% binary mixture amplified using the R. occidentalis-targeting primer sets. The black and orange dotted lines indicate the Ct values (cut-off Ct) for 0.1% binary mixtures amplified using the R. coreanus- and R. occidentalis-target primers, respectively. All reactions were performed in triplicate (n = 3).

The specificity test of the developed real-time assay for R. coreanus or R. occidentalis was performed using 15 different species, which may be used in medicinal herb products (Table 3). The primer sets (RC_matK, RC_atpA, and RC_rpoC2) targeting R. coreanus displayed high specificity based on cross-reactivity; no significant amplification was observed in 15 species, except R. coreanus. In addition, the primer sets (RO_matK, RO_rpoB, and RO_ITS) targeting R. occidentalis did not show significant amplification in all 15 plants, except R. occidentalis. These results indicate that all six primer pairs targeting R. coreanus and R. occidentalis had high specificity for detecting the intended target species without the false positives associated with the other 15 species.

Table 3.

Results of specificity test using the developed species-specific primer sets

NO Family Species Rubus coreanusRusbus occidentalis
matKatpArpoC2matKrpoBITS
Cut-off Ct values 26.22 26.97 25.64 25.56 26.05 24.43
1 RosaceaeRubus coreanusa++ ++ ++ - - -
2 Rubus occidentalisb- - - ++ ++ ++
3 CompositaeDendranthema indicum - - - - - -
4 Cirsium japonicum - - - - - -
5 Xanthium strumarium - - - - - -
6 Carthamus tinctorius - - - - - -
7 Atractylodes lancea - - - - - -
8 Artemisia capillaris - - - - - -
9 Artemisia gmelinii - - - - - -
10 Kalimeris yomena - - - - - -
11 FabaceaeGlycyrrhiza uralensis - - - - - -
12 ZingiberaceaeCurcuma longa - - - - - -
13 GraminaeZea mays - - - - - -
14 LiliaceaeVeratrum maackii - - - - - -
15 Hemerocallis fulva - - - - - -
16 ConvolvulaceaeIpomoea batatas - - - - - -

a++, indicates that the sample was amplified before target species cycles

b-, indicates no amplification before cut-off Ct cycles

Reliability verification of the developed primers using blind samples

To estimate the reliability of the developed qPCR molecular marker, a blinded test was performed using 25 samples. Blind samples were prepared by an independent research institute who did not provide any information on how the powders of R. coreanus and R. occidentalis were mixed before discrimination. A total of 25 blind samples were evaluated using the 18S rRNA primer set as a positive amplification control to ensure good DNA extraction. All samples had values ​​between 17.48 and 18.74 in the positive amplification control (Table 4). Subsequently, the samples were amplified by the developed primer pairs and determined based on Ct values ​​of 0.1% measured in binary mixture tests (RC_matK, 26.22; RC_atpA, 26.97; RC_rpoC2, 25.64; RO_matK, 25.56; RO_rpoB, 26.05; RO_ITS, 24.20) whether any species sample was or was not present in the mixed samples. Twenty-five samples had lower Ct values for the developed R. coreanus primer sets than the Ct values ​​of 0.1%, supporting the examined all have powders of R. coreanus. In contrast, higher Ct values ​​of the developed R. occidentalis primer sets were observed in seven samples (sample numbers:1, 5, 9, 15, 18, 19, and 20), indicating that the samples did not contain R. occidentalis powder. The other 18 samples had Ct values lower than the cut-off for the developed R. coreanus and R. occidentalis primers, indicating that R. coreanus and R. occidentalis powders were mixed. These results indicate that the developed primer sets are highly reliable for detecting the target species in R. coreanus and R. occidentalis mixed food products.

Table 4.

Result of blind test assessing the reliability of the developed species-specific primer sets

Primer sets R. coreanus and R. occidentalis blind test
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
Positive
control
18s
rRNA
18.741 18.263 18.163 18.204 18.311 18.012 17.712 17.645 18.212 17.830 17.866 17.482 18.063 17.877 17.865 18.280 18.052 18.350 18.643 18.106 17.933 17.969 18.186 18.263 18.298
±0.150 ±0.171 ±0.133 ±0.166 ±0.123 ±0.321 ±0.171 ±0.017 ±0.103 ±0.152 ±0.085 ±0.128 ±0.089 ±0.044 ±0.122 ±0.083 ±0.024 ±0.098 ±0.064 ±0.075 ±0.005 ±0.016 ±0.113 ±0.009 ±0.010
Rubus
coreanus
matK
Region
19.657 19.266 19.338 19.299 19.428 19.569 18.693 18.810 19.269 18.979 19.243 18.762 19.279 19.287 19.053 19.089 19.353 19.922 19.649 19.228 19.349 19.145 19.664 19.432 19.099
26.22
cyclea
±0.074 ±0.007 ±0.066 ±0.060 ±0.125 ±0.030 ±0.031 ±0.263 ±0.009 ±0.021 ±0.044 ±0.011 ±0.023 ±0.105 ±0.057 ±0.010 ±0.128 ±0.060 ±0.092 ±0.054 ±0.025 ±0.113 ±0.043 ±0.111 ±0.020
atpA
Region
19.654 19.169 19.235 19.237 19.206 19.558 18.603 19.299 19.279 19.163 19.149 18.904 19.280 19.552 19.197 19.571 19.689 20.256 19.855 19.667 19.581 19.546 19.925 19.935 19.564
26.97
cycle
±0.060 ±0.028 ±0.025 ±0.121 ±0.046 ±0.041 ±0.113 ±0.024 ±0.110 ±0.055 ±0.034 ±0.066 ±0.023 ±0.063 ±0.080 ±0.117 ±0.025 ±0.124 ±0.039 ±0.353 ±0.065 ±0.014 ±0.126 ±0.014 ±0.021
rpoC2
Region
19.022 18.357 18.558 18.714 18.867 18.980 18.035 18.224 18.358 18.317 18.330 18.025 18.424 18.748 18.306 18.625 18.677 19.093 18.840 18.701 18.690 18.775 18.967 18.845 18.652
25.64
cycle
±0.056 ±0.012 ±0.004 ±0.007 ±0.015 ±0.085 ±0.049 ±0.090 ±0.018 ±0.027 ±0.023 ±0.082 ±0.020 ±0.035 ±0.071 ±0.018 ±0.059 ±0.008 ±0.071 ±0.006 ±0.032 ±0.018 ±0.013 ±0.079 ±0.059
Rubus
occidentalis
matK
Region
33.283 25.535 23.929 24.244 32.222 23.260 21.756 23.262 25.919 22.186 21.917 22.917 21.989 25.034 26.763 22.974 21.752 32.040 31.619 34.755 21.030 21.584 21.177 22.409 21.249
25.56
cycle
±0.889 ±0.022 ±0.030 ±0.062 ±0.791 ±0.083 ±0.147 ±0.014 ±0.002 ±0.076 ±0.066 ±0.035 ±0.003 ±0.119 ±0.075 ±0.008 ±0.004 ±0.154 ±0.583 ±0.071 ±0.052 ±0.025 ±0.005 ±0.040 ±0.066
rpoB
Region
34.404 25.929 25.151 25.354 33.484 24.172 22.787 24.376 27.236 23.782 23.170 24.155 23.176 26.435 28.237 24.234 23.339 33.003 34.880 35.081 22.542 23.280 23.085 24.035 22.766
26.05
cycle
±1.174 ±0.030 ±0.009 ±0.063 ±1.048 ±0.010 ±0.189 ±0.142 ±0.165 ±0.007 ±0.088 ±0.083 ±0.096 ±0.107 ±0.060 ±0.038 ±0.099 ±0.138 ±0.698 ±0.559 ±0.017 ±0.025 ±0.030 ±0.040 ±0.105
ITS
Region
31.776 24.443 23.951 24.113 33.222 23.472 21.993 23.667 26.317 22.916 22.218 23.336 22.399 24.268 27.074 23.380 22.123 32.024 31.979 32.799 21.327 21.949 21.701 22.224 21.418
24.43
cycle
±0.132 ±0.971 ±0.004 ±0.028 ±1.095 ±0.008 ±0.112 ±0.206 ±0.013 ±0.073 ±0.018 ±0.030 ±0.001 ±0.003 ±0.126 ±0.101 ±0.168 ±0.139 ±0.103 ±0.378 ±0.104 ±0.127 ±0.107 ±0.117 ±0.047
Ingredient R_
coreanus
○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○
R_
occidentalis
× ○ ○ ○ × ○ ○ ○ × ○ ○ ○ ○ ○ × ○ ○ × × × ○ ○ ○ ○ ○

aValue under the name of the primer sets indicates the cut-off cycles of each designed DNA marker

The real-time PCR system developed in this study to distinguish between R. coreanus and R. occidentalis was found to have the high specificity and sensitivity necessary to detect both species in medicinal herb markers. Additionally, the reliability of the developed markers was verified using 25 blind samples. The developed six pairs of qPCR-based molecular markers could quickly and efficiently identify both species in commercial processed products, thereby contributing to food safety and the protection of consumer rights in medical herb markets.

Acknowledgements

This research was supported by a Grant (17162MFDS065) from the Ministry of Food and Drug Safety in 2021.

References

1
Arya, M., Shergill, I. S., Williamson, M., Gommersall, L., Arya, N., Patel, H. R. (2005) Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn 5:209-219. 10.1586/14737159.5.2.20915833050
2
Ekor, M. (2013) The growing use of herbal medicines: Issues relating to adverse reactions and challenges in monitoring safety. Front Neurol 4:177. 10.3389/fphar.2013.0017724454289PMC3887317
3
European Network of GMO Laboratories (ENGL) (2008) Definition of minimum performance requirements for analytical methods of GMO testing.
4
Hong, E., Lee, S. Y., Jeong, J. Y., Park, J. M., Kim, B. H., Kwon, K., Chun, H. S. (2017) Modern analytical methods for the detection of food fraud and adulteration by food category. J Sci Food Agric 97:3877-3896. 10.1002/jsfa.836428397254
5
Kane, D. E., Hellberg, R. S. (2016) Identification of species in ground meat products sold on the US commercial market using DNA-based methods. Food Control 59:158-163. 10.1016/j.foodcont.2015.05.020
6
Kim, L. S., Youn, S. H., Kim, J. Y. (2014) Comparative study on antioxidant effects of extracts from Rubus coreanus and Rubus occidentalis. J Korean Soc Food Sci Nutr 43:1357-1362. 10.3746/jkfn.2014.43.9.1357
7
Kim, Y. D., Uh, Y. R., Jang, C. S. (2022) Development of real-time PCR based molecular markers for two medicinal herb Artemisia species A. capillaris and A. iwayomogi. Food Sci Biotechnol 1-11. 10.1007/s10068-022-01166-036606092
8
Lo, Y. T., Shaw, P. C. (2018) DNA-based techniques for authentication of processed food and food supplements. Food Chemistry 240:767-774. 10.1016/j.foodchem.2017.08.02228946341
9
Minas, K., McEwan, N. R., Newbold, C. J., Scott, K. P. (2011) Optimization of a high-throughput CTAB-based protocol for the extraction of qPCR-grade DNA from rumen fluid, plant and bacterial pure cultures. FEMS Microbiology Letters 325:162-169. 10.1111/j.1574-6968.2011.02424.x22029887
10
Ministry of Food and Drug Safety (2022) The dispensatory on the visual and organoleptic examination of herbal medicine. 71-72, 80-81.
11
Oh, S. H., Jang, C. S. (2020). Development and validation of a real-time PCR based assay to detect adulteration with corn in commercial turmeric powder products. Foods 9:882. 10.3390/foods907088232635672PMC7404567
12
Oh, S. H., Kim, Y. D., Jang, C. S. (2022) Development and application of DNA markers to detect adulteration with Scopolia japonica in the medicinal herb Atractylodes lancea. Food Sci Biotechnol 31:89-100. 10.1007/s10068-021-01008-535059233PMC8733082
13
Patel, A. V., Rojas-Vera, J., Dacke, C. G. (2004) Therapeutic constituents and actions of Rubus species. Curr Med Chem 11:1501-1512. 10.2174/092986704336514315180580
14
Safdar, M., Junejo, Y. (2015) Development and validation of fast duplex real-time PCR assays based on SYBER Green florescence for detection of bovine and poultry origins in feedstuffs. Food Chemistry 173:660-664. 10.1016/j.foodchem.2014.10.08825466073
15
Şakalar, E., Kaynak, A. (2016) Practical Molecular Detection Method of Beef and Pork in Meat and Meat Products by Intercalating Dye Based Duplex Real-Time Polimerase Chain Reaction. Int J Food Prop 19:31-40. 10.1080/10942912.2015.1017049
16
Seo, J. M., Ahn, J. Y. (2004) Biological activities of rosaceae plants extracts. J Soc Cosmet Scientists Korea 30:499-502.
17
Uh, Y. R., Jang, C. S. (2022) Establishing DNA markers to differentiate Agastache rugosa and Pogostemon cablin, which are confusedly used as medicinal herbs, using real-time PCR. Food Sci Biotechnol 1-9. 10.1007/s10068-022-01176-y36647523
18
World Health Organization (WHO) (2002) Traditional Medicine Strategy 2002-2005: Geneva, Switzerland. WHO/EDM/TRM/2002.1.
19
World Health Organization (WHO) (2007) Health of Indigenous Peoples. Geneva, p.1132.
20
Xu, W., Zhai, Z., Huang, K., Zhang, N., Yuan, Y., Shang, Y., Luo, Y. (2012) A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis. PloS one 7:e22900. 10.1371/journal.pone.002290022272223PMC3260127
21
Yang, H. M., Lim, S. S., Lee, Y. S., Shin, H. K., Oh, Y. S., Kim, J. K. (2007) Comparison of the anti-inflammatory effects of the extracts from Rubus coreanus and Rubus occidentalis. Korean J Food Sci Technol 39:342-347.
22
Yuan, J. S., Reed, A., Chen, F., Stewart, C. N. (2006) Statistical analysis of real-time PCR data. BMC bioinformatics 7:1-12. 10.1186/1471-2105-7-8516504059PMC1395339
페이지 상단으로 이동하기