Research Article

Journal of Agricultural, Life and Environmental Sciences. 31 December 2025. 417-424
https://doi.org/10.22698/jales.20250034

ABSTRACT


MAIN

  • Introduction

  • Materials and Methods

  •   Sample collection and virus identification

  •   Host-response experiment

  •   Sequence analysis and phylogenetic analysis

  • Results and Discussion

  • Summary

Introduction

Atractylodes macrocephala is a perennial herbaceous plant belonging to the genus Atractylodes within the Asteraceae family, primarily growing in mountainous regions or dry grasslands. The rhizomes of Atractylodes plants and A. macrocephala have long been used as medicinal ingredients in traditional Korean medicine, particularly for treating various digestive disorders such as indigestion and gastritis (Zhu et al., 2018). Atractylodes macrocephala is a species introduced from China, known for its rapid growth, high yield, and excellent seed production, making it advantageous for cultivation and seed propagation. However, it has been reported to be more susceptible to disease compared to other plants in the genus Atractylodes. To date, the major viruses reported in A. macrocephala include Atractylodes mild mottle virus (AMMV), Atractylodes mosaic virus (AtrMoV), Broad bean wilt virus 2 (BBWV2), Pecan mosaic-associated virus (PMaV), and Cucumber mosaic virus (CMV) (Kwon et al., 2019; Lim et al., 2015; Niu et al., 2015, 2018; Zhao et al., 2015).

CMV is an economically significant plant virus with a broad host range infecting over 1,200 plant species worldwide, causing various symptoms, including mosaic and yellowing. The CMV genome consists of three single-stranded RNA segments, with RNA3 encoding the movement protein (MP) and coat protein (CP). These two proteins are known to play a crucial role in disease manifestation and host range determination (Mochizuki and Ohki, 2012). Therefore, comparative analysis of CMV strains isolated from specific host plants holds significant importance for understanding the virus's pathogenicity, host adaptability, and genetic diversity.

Although three CMV isolates separated from A. macrocephala in China and South Korea have been previously reported, systematic comparative studies analyzing their biological responses and molecular diversities are lacking (Kwon et al., 2019; Song et al., 2020). In this study, we analyzed the biological and molecular characteristics of CMV-Atm, newly isolated from A. macrocephala in the Chuncheon area of Gangwon Province, by comparing it with three previously isolated strains. Furthermore, we attempted to elucidate the genetic diversity of CMVs within the host plant, A. macrocephala, and the molecular characteristics associated with host adaptation by comparing RNA3 sequences.

Materials and Methods

Sample collection and virus identification

In 2020, A. macrocephala exhibiting distortion symptoms was collected in the Chuncheon area of Gangwon Province (Fig. 1). Total RNA was extracted from symptomatic leaves using the BCSTM Plant RNA Prep Kit (Biocube System Inc., Suwon, South Korea) to determine whether viral infection was present. The extracted total RNA was reverse transcribed into cDNA using M-MLV reverse transcriptase (Promega, Madison, WI, USA), with the 3’-terminal reverse primer used for detection. Reverse transcription-polymerase chain reaction (RT-PCR) was performed using rTaq polymerase (Takara, Japan) with the synthesized cDNA as a template.

https://cdn.apub.kr/journalsite/sites/ales/2025-037-04/N0250370412/images/ales_37_04_12_F1.jpg
Fig. 1.

Atractylodes macrocephala show distortion symptoms collected from Chuncheon, Korea.

The reverse transcription reaction conditions were set at 42°C for 1 h and 92°C for 5 min. PCR amplification was performed under the following conditions: 35 cycles of 30 s at 95°C, 30 s at 52°C, and 1 min at 72°C. Virus detection was performed using genus-specific primer sets for seven virus genera (Ilarvirus, Potyvirus, Fabavirus, Tospovirus, Potexvirus, Tobamovirus, and Cucumovirus), along with AMMV, AtrMoV, BBWV2, and PMaV-specific primers reported for A. macrocephala (Table 1). RT-PCR products were electrophoresed on a 1% agarose gel for 30 min, and bands were visualized under UV light.

Table 1

Primer list used for virus detection in A. macrocephala

Virus Primer name Sequence (5’-3’)1) Size (bp) Reference
AMMV AMMV-CP-F TGGCTGACATACTTGCAGAAGC 625 This study
AMMV-CP-R AGTGCCCTTGCTCACTGCA
AtrMoV AtrMV-CP-F ATGCCGCCCAAGCCTGAT 947 This study
AtrMV-CP-R TTACTGAAGACTCCGGTTATTCGC
BBWV2 BBWV2-506-F GGTGAGCAGTTTGTCAGAAGT 506 Choi et al. (2019)
BBWV2-506-R CCAGATAATGCATATTCCACC
PMaV PMaV-CP-F CCACCGCTAACTAGCGCT 750 This study
PMaV-CP-R AACATCATCGGTGGTGTGTC
Ilarvirus Ilar-5’ GCNGGWTGYGGDAARWCNAC 309 Untiveros et al. (2010)
Ilar-3’ AMDGGWAYYTGYTYNGTRTCACC
Fabavirus Faba-genus-5' AAATATTAAAACAAACAGCTTTCGTT 390 Ferrer et al. (2007)
Faba-genus-3' TTCAAAGCTCGTGCCATITYATTKGC
Tospovirus Tospovirus-5' TCIRDICKIYKRAAICTCMSRTC 450 Okuda and Hanada (2001)
Tospovirus-3’ GGGGGAGAGCAATYGWGTCA
Potexvirus Potexvirus-5 CAYCARCARGCMAARGAYGA 580 Van der Vlugt and Berendsen (2002)
Potexvirus-3 AGCATRGCISCRTCYTG
Potyvirus Poty-CI-For GGIVVIGTIGGIWSIGGIAARTCIAC 700 Ha et al. (2008)
Poty-CI-Rev ACICCRTTYTCDATDATRTTIGTIGC
Tobamovirus TobamodF TKGAYGGNGTBCCNGGNTGYGG 880 Li et al. (2018)
TobamodR ACNGAVTBNABCTGTAATTGCTAT
Cucumovirus CPT-All-F YASYTTTDRGGTTCAATTCC 950 Choi et al. (1999)
CPT-All-R GACTGACCATTTTAGCCG

1)I: inosine, Y: C/T, R: A/G, M: A/C, K: G/T, S: C/G, W: A/T, B: C/G/T, V: A/C/G, D: A/G/T, N: A/C/G/T

Host-response experiment

Mechanical inoculation was performed on 10 host plant species, including Nicotiana benthamiana (Table 2), to examine the host response of CMV-Atm. Leaves from A. macrocephala plant showing symptoms (1 g) were crushed in a mortar with 1 mL of 0.01 M phosphate buffer (pH 7.2) and used as an inoculum. The prepared extract was rubbed onto the leaf surface of the host plant treated with carborundum for inoculation. After the inoculation, plants were cultivated in a growth chamber maintained at 25°C–27°C and 60% relative humidity, with a 16-h light/8-h dark photoperiod.

Table 2

Host response to CMV-Atm

Family Host plants Symptoms of the leaves1)
JC2) Atm Fny3)
Solanaceae Nicotiana benthamiana -/sM -/M -/M
N. tabacum cv. Xanthi nc nt NS/M -/M
N. glutinosa -/sM NS/M -/M
Capsicum annuum cv. Cheongyang nt -/M -/M
C. annuum cv. Baerotta nt -/- -/-
C. annuum cv. Bukang nt -/- -/-
Chenopodiaceae Chenopodium quinoa nt NS/- NS/-
C. amaranticolor nt NS/- NS/-
Cucurbitaceae Cucumis sativus cv. Daesun nt -/CS -/M
Cucurbita pepo cv. Choigobong nt NS/CS -/M

1)Inoculated/upper leaves; sM, severe mosaic; M, mosaic; NS, necrotic spot; CS, chlorotic spot; -, no infection; nt, not tested.

CMV-JC2) and CMV-Fny3) were used as a control (Banik et al., 1983; Kwon et al., 2019)

Sequence analysis and phylogenetic analysis

RT-PCR was performed using the CMV-I-RNA3-F primer (5’-GTA ATC TTA CCA CTG TGT GTG-3’) and the SSVK3-3’-BamHI primer (5’-GCG GAT CCT GGT CTC CTT TGG AAG CCC-3’) to amplify the entire sequence of CMV-Atm RNA3 (Lee, 2007). The amplified PCR products were cloned into the pGEM T-easy TA cloning vector system (Promega, USA) and subsequently sequenced by Macrogen (Seoul, South Korea). The obtained nucleotide sequences were analyzed for homology using the BLASTn program from NCBI and MEGA10 software.

The phylogenetic analysis of CMV-Atm included sequences from 16 CMV isolates, with peanut stunt virus (PSV-ER) as the outgroup. The nucleotide sequences of other CMV isolates were obtained from the GenBank database. The sequences were subjected to multiple alignment using ClustalW in MEGA10 software. A phylogenetic tree was constructed using the maximum likelihood method with 1,000 bootstrap iterations (Fig. 2). Furthermore, the amino acid sequences of the coat protein from CMV-Atm and the existing A. macrocephala-derived CMV isolates were aligned and compared using the BioEdit program (Fig. 3).

https://cdn.apub.kr/journalsite/sites/ales/2025-037-04/N0250370412/images/ales_37_04_12_F2.jpg
Fig. 2.

Phylogenetic analysis based on the amino acid sequences of movement protein (A) and coat protein (B) of CMV-Atm, together with other CMV isolates including those derived from A. macrocephala. Phylogenetic analysis was conducted using the maximum likelihood method with 1,000 bootstrap replications implemented in MEGA 10 after multiple alignment by ClustalW. CMV isolates were classified into three subgroups, and peanut stunt virus (PSV-ER) was used as outgroup. The sequence of other CMV isolates were obtained from the GenBank database. The purple circle indicates CMV-Atm identified in this study, and the green circles represent previously reported CMV isolates from A. macrocephala.

https://cdn.apub.kr/journalsite/sites/ales/2025-037-04/N0250370412/images/ales_37_04_12_F3.jpg
Fig. 3.

Sequence alignment of coat protein (CP) amino acid sequences of CMV-Atm and other CMV isolates. Dots indicate positions with identical amino acid, and asterisks indicate a stop codon.

Results and Discussion

We tested whether virus infection was present in A. macrocephala exhibiting distortion symptoms in the Chuncheon region. After extracting total RNA from leaves exhibiting symptoms, RT-PCR testing was performed for previously reported viruses, i.e., AMMV, AtrMoV, BBWV2, and PMaV (Table 1). Supplementary tests using genus-specific primer sets for seven viral genera, i.e., Ilarvirus, Potyvirus, Fabavirus, Tospovirus, Potexvirus, Tobamovirus, and Cucumovirus., were also conducted to determine the potential infection of other viruses. RT-PCR results showed that only the test primer set within the Cucumovirus genus produced an amplification product of the expected size (approximately 950 bp) (data not shown). Sequence analysis of the amplified product confirmed that A. macrocephala was infected with CMV, and this isolate was designated CMV-Atm. The acquired nucleotide sequence showed 99.85% of sequence homology with that of the CMV-Ad71 isolated in Angelica dahurica (GenBank accession no. PV939598.1).

To examine the biological characteristics of CMV-Atm, mechanical inoculation was performed on 10 host plant species, including Nicotiana benthamiana (Table 2). Three days after inoculation, necrotic spots appeared on the inoculated leaves of N. tabacum cv. Xanthi nc, and N. glutinosa. Ten days after inoculation, typical mosaic symptoms were observed on the upper leaves of all tobacco plants. In Capsicum annuum, mosaic symptoms were found only in the susceptible cultivar 'Cheongyang'. In Chenopodium quinoa and C. amaranticolor, necrotic spots were observed only on the inoculated leaves. Additionally, yellow spots appeared on the upper leaves of the Cucurbit crops, including cucumber and zucchini.

When comparing these host responses to those of CMV-JC, previously isolated from A. macrocephala, and CMV-Fny, a representative CMV isolate, CMV-JC and CMV-Fny induced mosaic symptoms on the upper leaves of N. benthamiana and N. glutinosa. In contrast, CMV-Atm caused necrotic spots on the inoculated leaves (Kwon et al., 2019). Unlike CMV-Fny, which induced upper leaf mosaic symptoms in cucurbit crops, CMV-Atm caused yellow spots. These results indicated that CMV-Atm possesses distinct pathogenicity patterns in certain hosts (tobacco plants), while having a host range similar to that of typical CMV strains. Furthermore, CMV-Atm failed to infect or induce disease symptoms in resistant pepper varieties, indicating its inability to overcome resistance in these varieties.

To analyze the genetic characteristics of CMV-Atm, we performed phylogenetic analysis on the movement protein (MP) and coat protein (CP) genes encoded by RNA3. CMV-Atm was found to belong to the IB group within subgroup I in terms of both MP and CP (Fig. 2). This was similar to previously reported A. macrocephala-derived CMV strains. Meanwhile, CMV-Atm showed a higher association with the Chinese isolates CMV-ZJAm and CMV-Am than with the Korean isolate CMV-JC.

Additionally, we compared the CP amino acid sequences of CMV-Atm with those of three previously separated CMV isolates from A. macrocephala and various major isolates within subgroup I (Fig. 3). CMV-Atm exhibited amino acid sequences nearly identical to those of existing A. macrocephala-derived isolates. Particularly, amino acids at positions 91 and 168 of CMV-Atm were specific to those isolates from A. macrocephala, distinguishing them from other isolates belonging to subgroups IA and IB. The helix and β-sheet regions of the coat protein are known to be critical for the protein's structural stability and folding (Smith et al., 2000). In the CMV-Atm sequence, slight variation was observed in this region, suggesting that the CP of A. macrocephala–derived CMV isolates is highly conserved.

This study confirmed that CMV-Atm exhibits high phylogenetic similarity to existing isolates derived from A. macrocephala, yet displays distinct disease symptoms in certain host responses. This suggests that within A. macrocephala host, CMV maintains overall conservative evolution while accumulating host adaptation and variation at the level of pathogenicity-related genes or proteins.

Summary

Atractylodes macrocephala is a medicinal crop belonging to the Atractylodes genus, widely cultivated in China and South Korea. To date, five viruses have been reported to infect A. macrocephala. In this study, samples of A. macrocephala exhibiting distortion symptoms were collected in Chuncheon, Gangwon Province. RT-PCR testing was performed targeting five viruses reported on this host plant and seven virus genera commonly occurring in South Korea. As a result, an amplification product of the expected size was detected using a Cucumovirus genus-specific primer set. Sequence analysis confirmed infection with cucumber mosaic virus (CMV), and this isolate was designated CMV-Atm. Previously, CMV isolates identified in A. macrocephala have been reported in China and South Korea. Therefore, this study compared the biological and molecular characteristics of the newly isolated CMV-Atm with existing A. macrocephala–derived CMV isolates. CMV-Atm exhibited differences in pathogenicity and host response compared with existing isolates, yet showed high sequence homology with them in phylogenetic analysis. These results suggest that CMV-Atm possesses genetically conserved characteristics with existing CMV isolates derived from A. macrocephala, while exhibiting unique traits in the manifestation of disease symptoms, indicating the possibility of subtle adaptive processes occurring during host-pathogen interactions.

Acknowledgements

This study was supported by the Research Program for Agricultural Science & Technology Development (Project No. RS-2025-02263567), National Institute of Agricultural Sciences, Rural Development Administration, South Korea.

References

1

Banik, M. T., Zitter, T. A., Lyons, M. E. (1983) A difference in virus titer of two cucumber mosaic virus isolates as measured by ELISA and aphid transmission. Phytopathol 73:362.

2

Choi, S. K., Choi, J. K., Park, W. M., Ryu, K. H. (1999) RT-PCR detection and identification of three species of cucumoviruses with a genus-specific single pair of primers. J Virol Methods 83:67-73.

10.1016/S0166-0934(99)00106-8
3

Choi, S. A., Park, T. S., Park, J. S., Min, D. J., Hong, J. S. (2019) Comparison of genome sequence and biological properties of broad bean wilt virus 2 Isolates from Gynura procumbens. J Agric Life Environ Sci 31:121-127.

4

Ferrer, R. M., Luis-Arteaga, M., Guerri, J., Moreno, P., Rubio, L. (2007) Detection and identification of species of the genus Fabavirus by RT–PCR with a single pair of primers. J Virol Methods 144:156-160.

10.1016/j.jviromet.2007.03.010
5

Ha, C., Coombs, S., Revill, P. A., Harding, R. M., Vu, M., Dale, J. L. (2008) Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Arch Virol 153:25-36.

10.1007/s00705-007-1053-7
6

Kwon, S. J., Cho, I. S., Yoon, J. Y., Choi, G. S. (2019) First report of cucumber mosaic virus in Atractylodes macrocephala in Korea. Plant Dis 103:380.

10.1094/PDIS-07-18-1181-PDN
7

Lee, J. A. (2007) Biological diversity and sequence analysis of the Lily isolates of cucumber mosaic virus. J Agric Life Environ Sci 18:192-193.

8

Li, Y., Tan, G., Lan, P., Zhang, A., Liu, Y., Li, R., Li, F. (2018) Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers. J Virol Methods 259:122-128.

10.1016/j.jviromet.2018.06.012
9

Lim, S., Igori, D., Zhao, F., Yoo, R. H., An, T. J., Lim, H. S., Lee, S. H., Moon, J. S. (2015) Complete genome sequence of a tentative new caulimovirus from the medicinal plant Atractylodes macrocephala. Arch Virol 160:3127-3131.

10.1007/s00705-015-2576-y
10

Mochizuki, T., Ohki, S. T. (2012) Cucumber mosaic virus: Viral genes as virulence determinants. Mol Plant Pathol 13:217-225.

10.1111/j.1364-3703.2011.00749.x21980997PMC6638793
11

Niu, Y., Pang, X., Wang, D., Guo, S., Liu, Y. (2018) Deep sequencing analysis of a strain of pecan mosaic-associated virus infecting Atractylodes macrocephala Koidz. J Plant Pathol 100:249-255.

10.1007/s42161-018-0072-4
12

Niu, Y., Shi, X., Zhang, X., Zhao, H., Zhao, B. (2015) Molecular identification and sequence analysis of broad bean wilt virus 2 isolates from Atractylodes macrocephala Koidz. bing du xue bao = Chinese. J Virol 31:58-64.

13

Okuda, M., Hanada, K. (2001) RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template. J Virol Methods 96:149-156.

10.1016/S0166-0934(01)00321-4
14

Smith, T. J., Chase, E., Schmidt, T., Perry, K. L. (2000) The structure of cucumber mosaic virus and comparison to cowpea chlorotic mottle virus. J Virol 74:7578-7586.

10.1128/JVI.74.16.7578-7586.2000
15

Song, J. W., Hou, P. P., Fei, L. B., Long, K., Liu, Y., Gao, S. Q., Su, X., Ma, L. J. (2020) Complete genomic sequence analysis of Cucumber mosaic virus isolated from Atractylodes macrocephala Koidz. in Zhejiang. Acta Phytopathologica Sinica 50(2):251-254.

16

Untiveros, M., Perez-Egusquiza, Z., Clover, G. (2010) PCR assays for the detection of members of the genus Ilarvirus and family Bromoviridae. J Virol Methods 165:97-104.

10.1016/j.jviromet.2010.01.011
17

Van der Vlugt, R. A., Berendsen, M. (2002) Development of a general potexvirus detection method. Eur J Plant Pathol 108:367-371.

10.1023/A:1015644409484
18

Zhao, F., Igori, D., Lim, S., Yoo, R. H., Lee, S. H., Moon, J. S. (2015) Nucleotide sequence and genome organization of Atractylodes mottle virus, a new member of the genus Carlavirus. Arch Virol 160:2895-2898.

10.1007/s00705-015-2553-5
19

Zhu, B., Zhang, Q. L., Hua, J. W., Cheng, W. L., Qin, L. P. (2018) The traditional uses, phytochemistry, and pharmacology of Atractylodes macrocephala Koidz.: A review. J Ethnopharmacol 226:143-167.

10.1016/j.jep.2018.08.023
페이지 상단으로 이동하기